Molecular Biology Protocols | Bioinformatics

Visit MolecularStation for all the research and science information you need. Our protocols database, and bioinformatics databases will help you in your research regardless what field you are in. Our Science Forums will make it easy for you to get help for science questions, and discuss your research and its techniques with others. We have subdivided the sections into DNA, RNA, Protein, and Proteomics. Further subdivisions have been made to make it easier for you to find information and protocols.

Newest Science Features at Molecular Station

Unit Conversion Calculators!

Chemistry Calculators!

Chemical Property Listings with Company Suppliers - BETA!

Lab Company Showcase & Lab Equipment Auction Marketplace - COMING SOON

Vendor Product Listings - Improvements Coming Soon

Updates to Researcher Profiles and Abstract Updates - COMING SOON

Molecular Station - Monthly Article/Essay Prize Contest!

Want to make some extra money? Submit your science related essays/articles by emailing them as an attachment to articles[at]molecularstation[dot]com to Molecular Station and get a chance to win the monthly $50USD prize!! Do you have unused science related essays/articles that you are the author, just sitting on your hard drive? Now they can make you some money! Your articles will be features on Molecular Station with you as the author! Great to post on your resume/CV! Please see our prize giveaway terms before submitting.

Molecular Station - Prizes Giveaway!

We have already given out an Apple Iphone with $101 credit, and monetary gifts to the most helpful users of our forum in 2009! Congratulations Danfive (winner of the Iphone and $101 credit) and Aga! We are giving away several more Apple Iphones, and monetary gift certificates in the near future!! All you have to do is Join if you haven't already and start contributing! By asking more questions and answering more questions for others you will have a greater chance to win. Learn at the same time while helping out others. Rules and information about prizes etc to come soon. Check this thread out for details: Molecular Station Prize Giveaway

Winners will get either this baby or monetary gifts sent to their Paypal account:
prize apple iphone

Join the Biggest Science Community!

Just some of our featured members:
admin
admin

Kiki

Join Now to be a part of the coolest, biggest, and baddest Science and Research community on the net!
Just a few benefts our members get:
24/7 Help on the discussion forum!
Less Ads!
Awesome profile to customize and add your buddies to!
Get your FREE customizable blog and start blogging now!
FREE access to exclusive members areas including...
FREEE Uploads of Science Pictures!
FREE Storage of protocols and links to protocols (never lose your work ever again!)
FREE Webpage for your lab or personal space!
Exciting new features to come very soon!
and MUCH MUCH MORE!!!

Recent Forum Topics

Fmoc-Glu(protecting group) -OH to prevent lactam formation Hello, I'm hoping someone can help me with a problem we are having. I currently use Fmoc-Glu(OBzl)-Oh in my short peptide synthesis. However, the...
Ampliying part of a virus genome Hi all, I'm trying to make a standard curve for my Real-time PCR. I need to amplify part of my virus genome which is a ss RNA, positive sense...
looking for resaerch jobs in frederick, MD Hi everybody. This is Deepika. I am looking for jobs in research fields of Biochemistry & Molecular Biology. I have a masters in Biochemistry from...
help! establishing primers with endonucleases, overhang and codons I have chosen these primers: left: 5' GATGTTTAGTGTTGTGGTTGC 3' and right: 5' CCGCACCAAAGAGGAAGTAT 3' and endonucleases XhoI and NdeI and these...
Real Time PCR product size I have read that the optimal product size for the Real Time PCR is 75-150 bp. With the primers that I have picked, my product will be ~290 bp long. I...